haplogroup g origin

The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. In the Americas, the percentage of haplogroup G corresponds to the numbers of persons from Old World countries who emigrated. It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. Specifications for most markers have been previously reported,1, 17, 28 ISOGG 2011 (http://www.isogg.org/tree/). Capelli C, Brisighelli F, Scarnicci F et al. . Almost all haplogroup G1 persons have the value of 12 at short tandem repeat (STR) marker DYS392 and all will have the M285 or M342 SNP mutation which characterizes this group. Kivisild T, Rootsi S, Metspalu M et al. Article Article There are seeming pockets of unusual concentrations within Europe. Haplogroup G (M201) is a human Y-chromosome haplogroup. The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective. Nei M : Molecular Evolutionary Genetics. Y-chromosomal evidence of the cultural diffusion of agriculture in Southeast Europe. It is not found among Native Americans except where intermarriage with non-native persons has occurred. contracts here. The International Society of Genetic Genealogy (ISOGG) maintains the most up-to-date consensus version of haplogroup categories. G-M377, now also known as G2b1, has previously been designated G2b and G2c. Balanovsky O, Dibirova K, Dybo A et al. Parent Branch: G-FGC5081 Descendant branch(s): G-Z17084 G-Z45043 FTDNA Tree Link: Link YFull Info. PLoS One 2011; 6: e20232. The identities of the specific 19 loci that define the STR haplotypes are reported in Supplementary Table S3 and Figure 4 legend. This value of 12 is uncommon in other G categories other than G1. PLoS Biol 2010; 8: e1000536. Am J Hum Genet 2008; 82: 873882. It is a child of haplogroup M12'G. It was likely born in the East Asia around 32,000 years ago. A clade of closely related Ashkenazi Jews represent virtually all G2b persons, with just three other G2b haplotypes having been reported so far: one Turk from Kars in northeast Turkey near Armenia, one Pashtun, and one Burusho in Pakistan. Eur J Hum Genet 2003; 11: 535542. Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. There are multiple SNPs which so far have the same coverage as P15. Hg G is most common in the Caucasus with a maximum frequency exceeding 70% in North Ossetians,2, 3 decreasing to 13% in Iran4 and then rapidly dissipating further eastward. Two sources of the Russian patrilineal heritage in their Eurasian context. The fragments were run on the ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems). Men with the haplogroup G marker moved into Europe in Neolithic times. While neither knowledge of paleo-climate, archeology or genetic evidence from a single locus using modern populations provides an unimpeachable microcosm of pre-historical expansions, considering them together cautiously provides a contextual framework for discussion. More distantly, G2a3a-M406 occurs in Italy (3%) with a Td of 8100 years ago, consistent with the model of maritime Neolithic colonization of the Italian peninsula from coastal Anatolia and/or the Levant. The authors declare no conflict of interest. ISSN 1476-5438 (online) Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. A network of 61 G2c-M377 lineages from Europe, the Near/Middle East and Central and South Asia reveals founder lineages (one pronounced founder in Ashkenazi Jews and a far distant one among South Asian individuals) and diverged lineages (Supplementary Figure S1). Parallel evolution of genes and languages in the Caucasus region. Digora, North Ossetia has the highest known concentration of G in a single city, as 74% of the tested men were G.[14] Haplogroup G is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs. Several G-PF3359 subclades, based on shared STR markers, probably exist. Also for P15* and L91 lineages Td estimates, DYS19 was excluded owing to duplications in these lineages.36. Y-DNA haplogroups are useful to determine whether two apparently unrelated individuals sharing the same surname do indeed descend from a common ancestor in a not too distant past (3 to 20 generations). Various estimated dates and locations have been proposed for the origin of G-M201, most of them in Western Asia. Haplogroup G men who belong to this group, but are negative for all G2a subclades, are uncommon in Europe but may represent a sizeable group in so far poorly tested areas east of Turkey. OS thanks the Italian Ministry of the University: Progetti Ricerca Interesse Nazionale 2009 and FIRB-Futuro in Ricerca 2008 and Fondazione Alma Mater Ticinensins. The coalescent times (Td) of various haplogroups were estimated using the ASDo methodology described by Zhivotovsky et al,32 modified according to Sengupta et al.13 We used the evolutionary effective mutation rate of 6.9 104 per 25 years, as pedigree rates are arguably only pertinent to shallow rooted familial pedigrees,33 as they do not consider the evolutionary consequences of population dynamics including the rapid extinction of newly appearing microsatellite alleles. Haplogroup G2a1 (also known as G-FGC753 and previously as G-L293) and its subclades represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. In addition, we introduce five new markers: M426, M461, M485, M527 and M547 (Supplementary Table S2). Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. Croat Med J 2005; 46: 502513. They arewith accompanying Y-chromosome locationsU5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). IK thanks the Russian Foundation for Basic Research for grant 08-06-97011 and the Grant of the President of the Russian Federation of state support for young Russian scientists MK-488.2006.4. The effective mutation rate at Y chromosome short tandem repeats, with application to human population-divergence time. The frequency data were converted into isofrequency maps using the Surfer software (version 8, Golden Software, Inc., Golden, CO, USA), following the kriging algorithm using advanced options to use bodies of waters as breaklines. In contrast to G1, the absolute majority of hg G samples belonged to G2-P287-related sub-clades, with the vast majority of them being associated with G2a-P15-related lineages. The M201 SNP mutation that characterizes haplogroup G was identified at Stanford University and was first reported in 2001. The hg G individuals in Supplementary Table S1 were either first genotyped for this study or updated to present phylogenetic resolution from earlier studies.2, 4, 10, 11, 13, 16, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 All hg G (M201-derived) samples were genotyped in a hierarchical manner for the following binary markers: M285, P20, P287, P15, L91 P16, M286, P303, U1, L497, M406, Page19, M287 and M377. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters. [29][30][31] 3% of North African Berbers were found to be haplogroup G.[32] 2% of Arab Moroccans and 0.8% of Berber Moroccans were likewise found to be G.[33]. The presence of the SNP P18 mutation characterizes G2a1a's only subclade, G2a1a. Although the phylogenetic resolution within hg G has progressed,1, 17 a comprehensive survey of the geographic distribution patterns of significant hg G sub-clades has not been conducted. The double 19 value situation is not seen in the G2a1 and G2a3 subclades. The hg G2a3b1c-L497 sub-cluster, on the other hand, has so far been found essentially in European populations and therefore is probably autochthonous to Europe. New York: Columbia University Press, 1987. A subset of 693 samples was typed for short tandem repeats of Y-chromosome (Y-STRs) using the 17 STR markers in the Applied Biosystems AmpFlSTR Yfiler Kit according to manufacturer recommendations. Am J Hum Genet 2012; 90: 573. See more. Samples from persons with British Isles, Sicilian and Turkish ancestry have been identified. Zalloua PA, Xue Y, Khalife J et al. Mol Biol Evol 2011; 29: 359365. Hg G also occurs at frequencies ranging from 5 to 15% in both the rest of Near/Middle East and southern European countries (especially Italy and Greece), with a decreasing frequency gradient towards the Balkans and northern Europe. Although hg G1 frequency distribution, overall, extends further eastward as far as Central Asian Kazakhs (present even among Altaian Kazakhs38 with identical STR haplotypes compared with the main Kazakh population), it is virtually absent in Europe. Although the low frequency of hg G1-M285 makes it impractical to justify displaying a spatial frequency map, it is found (Supplementary Table S1) in the Near/Middle East including Anatolia, the Arabian Peninsula and Persian Gulf region, as well as Iran and the South Caucasus (mostly Armenians). A majority of members of G-P303 belong to one of its subclades, rather than to G-P303*, The largest G-P303* subclade based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. These are found at: rs9786910, rs9786537, rs2713254, rs35567891 and rs34621155 on the Y chromosome. Russ J Genet 2004; 40: 326331. The next largest subclade of G-P303 is characterized by the presence of the U1 mutation. Nonetheless, coalescent times provide a valuable/informative relative metric for estimating the time of lineage formation. Cinnioglu C, King R, Kivisild T et al. The Morans I coefficient was calculated using the PASSAGE software v.1.1 (Phoenix, AZ, USA) with binary weight matrix, nine distance classes and random distribution assumption. In other words, these mutations are so unique that they could only come from other cells with the same mutations. Eur J Hum Genet 2010; 18: 463470. Y-STR haplotypes were used to construct phylogenetic networks for haplogroups G-P303, G-P16 and G-M377, using the program Network 4.6.0.0 (Fluxus-Engineering, Suffolk, England, UK) and applying the median-joining algorithm. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa. Although compared with G1-M285, the phylogenetic level of P303 (Figure 1) is shallower but its geographic spread zone covers the whole hg G distribution area (Figure 2b). Men with the haplogroup G marker moved into Europe in Neolithic times. Haplogroup G is observed in this survey as G1-M285 and G2a-P15. Mol Biol Evol 2006; 23: 22682270. The origin of haplogroup G is controversial. (a)(f) Spatial frequency maps of haplogroup G (hg G) and its sub-clades with frequencies over 10%. Am J Hum Genet 2007; 80: 759768. Semino O, Magri C, Benuzzi G et al. Semino O, Magri C, Benuzzi G, Lin AA, Al-Zahery N, et al. The G-P303 phylogenetic network was constructed using 248 G2a3b-P303-derived 19-locus haplotypes from populations representing Europe, Middle/Near East, South/Central Asia and the Caucasus and belonging to five sub-clades P303*, U1, M527, M426 and L497. However, its sub-clades have more localized distribution with the U1-defined branch largely restricted to Near/Middle Eastern and the Caucasus, whereas L497 lineages essentially occur in Europe where they likely originated. G2a1a persons also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons. Hg G is very frequent in NW Caucasus and South Caucasus, covering about 45% of the paternal lineages in both regions2 in this study. Gurdeep Matharu Lall, Maarten H. D. Larmuseau, Mark A. Jobling, Hovhannes Sahakyan, Ashot Margaryan, Richard Villems, Javier Rodriguez Luis, Leire Palencia-Madrid, Rene J. Herrera, Sandra Oliveira, Alexander Hbner, Jorge Rocha, Alessandra Modi, Desislava Nesheva, David Caramelli, Maxat Zhabagin, Zhaxylyk Sabitov, Elena Balanovska, Veronika Csky, Dniel Gerber, Anna Szcsnyi-Nagy, European Journal of Human Genetics Genome Res 2008; 18: 830838. Battaglia V, Fornarino S, Al-Zahery N et al. Ann Hum Genet 2004; 68: 588599. Barac L, Pericic M, Klaric IM et al. G2a2b1 is more common in southern Europe than northern Europe. Spatial frequency maps for sub-clades (panels bf) were obtained by applying the frequencies from Supplementary Table S1 using the Surfer software (version 8, Golden Software, Inc.), following the kriging algorithm with option to use bodies of water as breaklines. Its estimated Td of 120953000 years ago suggests considerable antiquity allowing time to accumulate STR diversity and also to disperse relatively widely. G1-M285, previously described in the Iranian population . Considering these issues, we acknowledge that the variance of the age estimates may be underestimated. Zhivotovsky LA, Underhill PA, Cinnioglu C et al. [38][self-published source?] Eur J Hum Genet 2010; 18: 348353. The 96 populations were collapsed into 50 regionally defined populations by excluding populations where the total G count was less than n=5. Summary. We emphasize that our assessments are based solely on contemporary DNA distributions rather than actual prehistoric patterns. The haplogroups contain many branches called subhaplogroups or subclades. https://doi.org/10.1038/ejhg.2012.86, DOI: https://doi.org/10.1038/ejhg.2012.86. The origin of haplogroup G is controversial. G-P16 is also occasionally present in Northeast Caucasus at lower frequencies (Supplementary Table S1), consistent with a previous report.3 Outside the Caucasus, hg G-P16 occurs at 1% frequency only in Anatolia, Armenia, Russia and Spain, while being essentially absent elsewhere. [44] The "U" SNPs were identified in 2006 but not published until 2009.[45]. It was then learned that several subclades belong under L223, including: G-L91 was identified in 2009. G-L91 would seem to encompass a significant proportion of men belonging to G. L91 is found so far in scattered parts of Europe and North Africa and in Armenia. Y chromosome sequence variation and the history of human populations. To obtain M286 was first identified at Stanford University at chromosome position 21151187, and is a mutation from G to A. The genetic heritage of the earliest settlers persists both in Indian tribal and caste populations. A network analysis of representative hg G-P16 Y-STR haplotypes reveals a diffuse cluster (Supplementary Figure S2). The G-M286 subclade (M286+) is small compared with G-L91. Rosser ZH, Zerjal T, Hurles ME et al. The corresponding coalescent estimate for M377 is 5600 years ago (Supplementary Table S4). The coming of the Greeks to Provence and Corsica: Y-chromosome models of archaic Greek colonization of the western Mediterranean. The authors of the Spanish study indicated that the Avellaner men had rare marker values in testing of their short tandem repeat (STR) markers. Ann Hum Genet 2008; 72: 205214. SR thanks the Estonian Science Foundation for grant 7445 and M Metspalu for grant 8973. This video explains the migration route of Y-chromosome haplogroup G and the countries where it can be found today. Y-chromosome lineages from Portugal, Madeira and Acores record elements of Sephardim and Berber ancestry. Internet Explorer). Network of 248 samples P303 derived from Supplementary Table S3. The members of G-PF3359 are probably smaller in number than men included in G-P303, but only a small amount of testing has occurred for the relevant mutations. L2b1a. A high percentage of G-Z1903 men belong to its subclade, G-Z724. This is not surprising, as clines are not expected in cases of sharp changes in haplogroup frequency over a relatively small distance such as those observed for hg G, for instance between the Caucasus and Eastern Europe. Amongst the Madjars, G1 was found at a rate of 87%. The reliability of both P16 and P18 in identifying everyone in each of these categories has been questioned and individual components of the SNP have to be examined. Encyclopedia of mtDNA Origins - Discover your maternal lineage. Ashkenazi Jewish G2a1a men with northeastern European ancestry form a distinct cluster based on STR marker values. To accommodate for variability in sample sizes and hg G content, haplogroup diversity was calculated using the method of Nei37 only in the 52 instances when total population sample size exceeded 50 individuals and 5hg G chromosomes were observed. However, interpretations based on simple haplogroup frequency clines do not recognize underlying patterns of genetic diversification. Eur J Hum Genet 2008; 16: 374386. The most commonly occurring subclades are G1* (M285) and many subclades of G2 (G-P287), especially: G2a (P15), G2a1 (G-FGC7535, formerly G-L293), G2a2b2a (G-P303) formerly G2a3b1); G2a2b1 (G-M406) formerly G2a3a; G2a2b2a1 (G-L140) formerly G2a3b1a; G2a2b2a1a1b (G-L497) formerly G2a3b1a2; G2a2b2a1a1a1 (G-L13) formerly G2a3b1a1a; G2a2b2a1a1c1a (G-CTS5990 or G-Z1903) formerly G2a3b1a3; G2b (G-M3115) and; G2b1 (G-M377), formerly G2b. Haplogroup H dominates present-day Western European mitochondrial DNA variability (>40%), yet was less common (~19%) among Early Neolithic farmers (~5450 BC) and virtually absent in Mesolithic . It is notable that tzi the 5300-year-old Alpine mummy was derived for the L91 SNP and his autosomal affinity was nearest to modern Sardinians.28, The G2a2-M286 lineage is very rare, so far detected only in some individuals in Anatolia and the South Caucasus. Slider with three articles shown per slide. Farther north, 8% of ethnic Hungarian males and 5.1% of ethnic Bohemian (Czech) males have been found to belong to Haplogroup G. In South Asia, some ethnic minorities possess haplogroup G at concentrations of approximately 18%[21] to 20%[22] of Kalash, approximately 16% of Brahui,[22] and approximately 11.5% of sampled Pashtun,[21] but in only about 3% of the general Pakistani population. Using Y-STR data, the Td expansion time for all combined P15-affiliated chromosomes was estimated to be 150822217 years ago. Marie Lacan, Christine Keyser, Franois-Xavier Ricaut, Nicolas Brucato, Francis Duranthon, Jean Guilaine, Eric Crubzy, and Bertrand Ludes, Ancient DNA reveals male diffusion through the Neolithic Mediterranean route. Hum Genet 2009; 126: 707717. Am J Hum Genet 2004; 74: 788788. This haplogroup was found in a Neolithic skeleton from around 5000 BC, in the cemetery of Derenburg Meerenstieg II, Germany, which forms part of the Linear Pottery culture, known in German as Linearbandkeramik (LBK),[11] but was not tested for G2a3 subclades. Cavalli-Sforza L, Menozzi P, Piazza A : The History and Geography of Human Genes. Nature 2010; 466: 238242. The G2 clade consists of one widespread but relatively infrequent collection of P287*, M377, M286 and M287 chromosomes versus a more abundant assemblage consisting of G2a-related P15*, P16 and M485-related lineages. Important caveats to consider include the fact that Td is sensitive to authentic rare outlier alleles and that multiple founders during population formation will inflate the age estimate of the event. [26][27] Among the Druze mostly residents of Israel 10% were found to be haplogroup G.[28], Around 10% of Jewish males are Haplogroup G.[citation needed], In Africa, haplogroup G is rarely found in sub-Saharan Africa or south of the horn of Africa among native populations. First, here is the only region with co-presence of deep basal branches as well as the occurrence of high sub-haplogroup diversity of haplogroup G. Haplogroup G was the first branch of Haplogroup F outside of Africa. Finally, to the east, G2a3a-M406 has an expansion time of 8800 years ago in Iran, a time horizon that corresponds to the first Neolithic settlements of the Zagros Mountains of Iran. Similarly, G-P16 and G-M377 networks were created using 104 P16-derived 19-locus haplotypes and 61G-M377-derived 9-locus haplotypes, with both groups representing European, Near/Middle Eastern and central/west Asian populations. Although no basal G-M201* chromosomes were detected in our data set, the homeland of this haplogroup has been estimated to be somewhere nearby eastern Anatolia, Armenia or western Iran, the only areas characterized by the co-presence of deep basal branches as well as the occurrence of high sub-haplogroup diversity. . SD was also calculated for the age estimates according to the following formula: 25/1000 (ASD0 variance)/0.00069. Eur J Hum Genet 2009; 17: 820830. King RJ, DiCristofaro J, Kouvatsi A et al. EKK thanks the Russian Academy of Sciences Program for Fundamental Research Biodiversity and dynamics of gene pools, the Ministry of Education and Science of the Russian Federation for state contracts P-325 and 02.740.11.07.01, and the Russian Foundation for Basic Research for grants 04-04-48678- and 07-04-01016-. This is achieved by comparing the haplotypes through the STR markers. Among Turkish males 11% of the population is G.[6] In Iran, Haplogroup G reaches 13 to 15% of the population in various parts of the country. (b) Principal component analysis by hg G sub-clades: (A) M285, P20, P287, P15, L92 P16, M286, M485, P303, U1, L497, M527, M406, Page19, M287 and M377 sub-haplogroups with respect to total M201. The SNP L177 (a.k.a. ASD0 is the average squared difference in the number of repeats between all current chromosomes of a sample and the founder haplotype, which is estimated as the median of current haplotypes. On this Wikipedia the language links are at the top of the page across from the article title. and JavaScript. Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF : New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. G2a3a-M406 has a modest presence in Thessaly and the Peloponnese (4%),10 areas of the initial Greek Neolithic settlements. [15] Among the samples in the YHRD database from the southern Caucasus countries, 29% of the samples from Abazinia, 31% from Georgia, 2% from Azerbaijan and 18% from Armenia appear to be G samples. The final major subclade is characterized by presence of the SNP Z1903 and by a value of 9 at marker DYS568. Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau. This is likely due to a local founder effect.[40]. RV and DMB thank the European Commission, Directorate-General for Research for FP7 Ecogene grant 205419. Kaniewski D, Van Campo E, Van Lerberghe K et al. Phylogenetic relationships of studied binary markers within haplogroup G in wider context of M89-defined clade. Human Y chromosome DNA grouping common in western Eurasia, This article is about the human Y-DNA haplogroup. See: Poznik. G1 is possibly believed to have originated in Iran. (2004) Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the . Its identification caused considerable renaming of G categories. In the Near/Middle East, the highest P303 frequency is detected among Palestinians (17.8%), whereas in Europe the frequency does not exceed 6%. Y-chromosomal diversity in Lebanon is structured by recent historical events. The Network 4.6.0.0 (Fluxus-Engineering) program was used (median-joining algorithm and the post-processing option). [10], A skeleton found at the Neolithic cemetery known as Derenburg Meerenstieg II, in Saxony-Anhalt Germany, apparently belonged to G2a3 (G-S126) or a subclade. L141 persons who do not belong to any L141 subclade so far have the value of 11 at STR marker DYS490 a finding rare in other G categories. International Society of Genetic Genealogy (ISOGG; 2015), "Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences", https://en.wikipedia.org/w/index.php?title=Haplogroup_G-M201&oldid=1139571590, Articles with dead external links from January 2020, Articles with permanently dead external links, All articles with bare URLs for citations, Articles with bare URLs for citations from April 2022, Articles with spreadsheet file bare URLs for citations, Short description is different from Wikidata, Articles with self-published sources from October 2020, Articles with unsourced statements from November 2017, Articles with unsourced statements from September 2022, Articles with unsourced statements from July 2017, Wikipedia articles in need of updating from February 2021, All Wikipedia articles in need of updating, Creative Commons Attribution-ShareAlike License 3.0, M201, PF2957, L116, L154, L204, L240, L269, L402, L520, L521, L522, L523, L605, L769, L770, L836, L837, M201, P257/U6, Page94/U17, U2, U3, U7, U12, U20, U21, U23, U33, Other males purported to be members of Haplogroup G include: German-American pioneer and soldier, This page was last edited on 15 February 2023, at 20:17. The highest percentage of G-P303 persons in a discrete population so far described is on the island of Ibiza off the eastern Spanish coast. The phylogeny obtained for haplogroup Q-M378 comprising 5.2% of the Ashkenazi paternal variation 24, shows a similar pattern to that observed for haplogroup G-M377 (Supplemental Figure S5). The Sea Peoples, from cuneiform tablets to carbon dating. Interestingly, the L30 SNP, phylogenetically equivalent to M485, M547 and U8, was detected in an approximately 7000-year-old Neolithic specimen from Germany, although this ancient DNA sample was not resolved further to additional sub-clade levels.39. The geographic origins of a Y chromosome haplogroup for males can be deciphered from the phylogenetic tree of mankind, or the Y-DNA Haplogroup Tree, maintained by the International Society of Genetic Genealogy ( ISOGG, 2016 ). The naming of sub-clades is according to YCC nomenclature principles. Haplogroup P (P295) is also klnown as K2b2. PLoS One 2009; 4: e5792. In 2012, SNPs with the Z designation as first identified by citizen researchers from 1000 Genomes Project data began to appear. Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the Mediterranean area. The phylogenetic relationships of the various sub-haplogroups investigated are shown in Figure 1. [23] About 6% of the samples from Sri Lanka and Malaysia were reported as haplogroup G, but none were found in the other coastal lands of the Indian Ocean or Pacific Ocean in Asia. Two additional markers, DYS38829, 30 and DYS46131 were typed separately. G-M201 has also been found in Neolithic Anatolian sites such as Boncuklu dating back to 8300-7600 BCE, and Barcin dating back to 6419-6238 BCE. Forensic Sci Int-Gen 2007; 1: 287290. Behar DM, Yunusbayev B, Metspalu M et al. Origin. The mutations involved may be complicated and difficult to interpret. The network was obtained using the biallelic markers P303, M426, L497, U1, M527 and 19 STR loci (DYS19, DYS388, DYS389I, DYS389b, DYS390, DYS391, DYS392, DYS393, DYS439, DYS461 (TAGA counts), DYS385a,b, DYS437, DYS438, DYS448, DYS456, DYS458, DYS635, YGATAH4).